Thank you for visiting nature.com. You are using a browser version with limited support for CSS. To obtain the best experience, we recommend you use a more up to date browser (or turn off compatibility mode in Internet Explorer). In the meantime, to ensure continued support, we are displaying the site without styles and JavaScript.
Scientific Reports volume 12, Article number: 15706 (2022 ) Cite this article Beauveria Bassiana Products

An Author Correction to this article was published on 09 November 2022
This article has been updated
Beauveria bassiana and Metarhizium anisopliae are two of the most important and widely used entomopathogenic fungi (EPFs) to control insect pests. Recent studies have revealed their function in promoting plant growth after artificial inoculation. To better assess fungal colonization and growth-promoting effects of B. bassiana and M. anisopliae on crops, maize Zea mays seedlings were treated separately with 13 B. bassiana and 73 M. anisopliae as rhizosphere fungi in a hydroponic cultural system. Plant growth indexes, including plant height, root length, fresh weight, etc., were traced recorded for 35 days to prove the growth promoting efficiency of the EPFs inoculation. Fungal recovery rate (FRR) verified that both B. bassiana and M. anisopliae could endophytically colonize in maize tissues. The recovery rates of B. bassiana in stems and leaves were 100% on the 7th day, but dropped to 11.1% in the stems and 22.2% in the leaves on the 28th day. Meanwhile, B. bassiana was not detected in the roots until the 28th day, reaching a recovery rate of 33.3%. M. anisopliae strains were isolated from the plant roots, stems and leaves throughout the tracing period with high recovery rates. The systematical colonization of B. bassiana and M. anisopliae in different tissues were further corroborated by PCR amplification of fungus-specified DNA band, which showed a higher detection sensitivity of 100% positive reaction. Fungal density comparing to the initial value in the hydroponic solution, dropped to be well below 1% on the 21st day. Thus, the two selected entomopathogenic fungal strains successfully established endophytic colonization rather than rhizospheric colonization in maize, and significantly promoted its growth in a hydroponic cultural system. Entomopathogenic fungi have great application potential in eco-agricultural fields including biopesticides and biofertilizers.
Entomopathogenic fungi (EPFs) have been proven as important biological control agents (BCAs) against various pests due to their wide host range, simple production, good durability and strong virulence1,2,3. Beauveria bassiana and Metarhizium anisopliae, were commercially used as a sustainable control strategy for key insect pests of maize, including corn borer Ostrinia furnacalis and Helicoverpa armigera in China, to avoid the abuse of chemical pesticides4. In fungi-based pest management, the triangle relationship among plants, insect pests and the fungi is of much higher complexity over the relationship between insect pests and fungal pathogens.
Many plants are symbiotic with endophytic fungi5, which live in plant tissues and do no obvious harm to plants6. Endophytic fungi are inherent organisms after establishing a mutually beneficial and cooperative symbiosis with their hosts7, and they can directly or indirectly promote plant growth and improve plant adaptability to adversity, including biological and abiotic stress8,9,10. Endophytes have important phylogenetic and lifestyle diversity characteristics, such as colonization, transmission, plant host specificity and colonization in different plant tissues11. Employing EPFs as endophytic fungi has aroused increasing interest from researchers and has unfolded many unique benefits as compared to their traditional counterparts.
B. bassiana and M. anisopliae can colonize a variety of plants, including but not limited to wheat, soybean, rice, bean, onion, tomato, palm, grape, potato and cotton12. Local or systematic colonization can happen mainly in the roots, stems, leaves and internal tissues of plants11. The fungal endophytic colonization can promote plant growth after artificial inoculation with seed treatment, foliar spraying and soil irrigation, etc.13,14,15,16. Treating crop seed with B. bassiana and M. anisopliae resulted in successful endophytic colonization in crop tissues and promoted crop growth, as evidenced by stem height, root length, fresh root and fresh stem weight17,18,19. Soil inoculation and foliar spraying of B. bassiana are also the most used application method which considerably enhanced the growth of corn seedlings20.
The purpose of this study was to evaluate growth-promoting effects and colonization behavior of B. bassiana and M. anisopliae on maize (Zea mays) seedlings and the influence on the plant growth under a hydroponic cultural system.
Both B. bassiana and M. anisopliae treatment led to an apparently positive effects on maize growth as observed during the 35-day period. As shown in Fig. 1, the growth promotion effect of the fungi on different maize organs is dependent on the growing stages.
Growth status of maize seedlings in different treatments over time. From left to right different colour line represents maize seedlings of Control, B. bassiana treatment and M. anisopliae treatment, respectively.
Temporal effects of B. bassiana and M. anisopliae on growth indexes of maize.
On the 7th day, the aboveground fresh weight (df = 23, F = 12.647, P = 0.000), underground fresh weight (df = 23, F = 18.857, P = 0.000) and total fresh weight (df = 23, F = 18.762, P = 0.000) of maize seedlings in the treatment groups were significantly higher (> 20%) than those in the control group, while other indexes showed no observable difference (Table 1). On the 28th day, crop height (df = 23, F = 10.452, P = 0.001), root (df = 23, F = 10.109, P = 0.001), leaf length (df = 23, F = 6.092, P = 0.009) and the aboveground fresh weight (df = 23, F = 11.310, P = 0.001) values were significantly higher in the treatment groups (Figs. 1 and 2). On the 35th day (Table 2), plant height (P = 0.000), root length(P = 0.003), leaf length (P = 0.002), leaf width (P = 0.015), leaf number (P = 0.1118), above-ground fresh weight (P = 0.004), underground fresh weight (P = 0.062) and total fresh weight (P = 0.007) values of the B. bassiana treated group were 17.87%, 48.26%, 20.37%, 36.97%, 9.38%, 85.54%, 81.49% and 84.87% higher than those of the control groups, respectively. Meanwhile, as learned in the M. anisopliae treated group, plant height (P = 0.000), root length (P = 0.203), leaf length (P = 0.005), leaf width (P = 0.004), leaf number (P = 0.118), above-ground fresh weight(P = 0.004), underground fresh weight(P = 0.029) and total fresh weight (P = 0.006) were 11.76%,12.08%, 17.84%, 19.68%,9.38%,57.74%, 92.71% and 63.45% higher than those of the control group.
The B. bassiana population decreased sharply from 5.92 × 103 to 22.3 CFUs/ml over the first week and 7.20 CFUs/ml over the second week. B. bassiana wasn’t detected in the hydroponic solution on the 21st day (Table 3). The M. anisopliae population also exhibited a rapid decrease from the initial density of 8.56 × 103 to 5.55 × 102 CFUs/ml over the first week. Then, 1.27 × 102 CFUs/ml and 17 CFUs/ml were detected on the 14th and 21st days respectively, while the solution was free of M. anisopliae on the 28th day.
Fungal colonies began to appear 4 days after the cultivation. The spore morphology, mycelial characteristics and colony characteristics of the isolated strains were observed under light microscope. The fungal conidiogenous cell of B. bassiana formed a zigzag curve, and the conidia were spherical, transparent and smooth, consistent with the morphology of the pure strain B. bassiana Bb-1321 (Fig. 3a). The fungal colonies of M. anisopliae were white in the beginning and turned olive green after sporulation. The hyphae were transparent, separated and branched. Bottle-shaped conidiogenous cells formed a long string of conidia in basal continuity (Fig. 3b). The conidia were elliptical, consistent with the morphology of pure strain Ma73. In general, B. bassiana (Fig. 3A–C) and M. anisopliae (Fig. 3D–F) were isolated from maize tissues by culturing tissue samples on the fungal selective medium, verifying their endophytic colonization in maize root, stem and leaf.
Fungal colonies of entomopathogenic fungi from maize seedling tissues on selective medium B. bassiana treatment group: A: Root; B: Stem; C: Leaf; (a) Morphology microscope of isolated fungi M. anisopliae treatment group: D: Root; E: Stem; F: Leaf; (b) Electron microscope of isolated fungi.
PCR amplification of special DNA band for B. bassiana(441 bp) and M. anisopliae(150 bp) from different tissues of fungal treated maize seedlings was also used to trace endophytic colonization of B. bassiana (Fig. 4a) and M. anisopliae (Fig. 4b) in crop tissues. This method was proved to be highly sensitive. Maize tissues, in which B. bassiana or M. anisopliae colony could not be detected on the selective medium, all responded to positive PCR amplification. Genomic DNA extracted from maize seedling tissues of the control group failed to amplify.
PCR amplification of genomic DNA extracted from different plant parts of B. bassiana and M. anisopliae treated Zea mays (a) Bb13; Lanes 1, 100 bp—1 kb DNA ladder; Lane 2–4, DNA from Zea mays root; Lane 5–7, DNA from Zea mays steam; Lane 8–10, DNA from Zea mays leaf. (b) Ma73; Lanes 10, 100—600 bp DNA ladder; Lane 1–3, DNA from Zea mays root; Lane 4–6, DNA from Zea mays steam; Lane 7–9, DNA from Zea mays leaf.
As discussed above, both B. bassiana and M. anisopliae successfully colonized in different tissues of maize seedlings. The fungal recovery rate (FRR) of B. bassiana or M. anisopliae from different tissues of maize seedlings revealed fungal temporal and spatial colonization in maize tissues (Table 4). On the 7th day after fungal inoculation, 100% FRRs were observed in stems and leaves for B. bassiana and M. anisopliae, while FRR from the roots was only 11.1% for M. anisopliae, and 0% for B. bassiana. M. anisopliae was successfully detected in maize roots, leaves and stems in every sampling time with a fluctuating FRR, reaching almost 100% FRRs in all tissues. For B. bassiana, FRR was relatively lower than that of M. anisopliae. Only on the 28th day, B. bassiana was detected in all maize organs. Fungal endophytic behavior showed somewhat fungal species specificity.
The colonization of B. bassiana and M. anisopliae in maize tissues was further detected by PCR amplification. Table 5 showed that the colonization rates of B. bassiana in tissues of all maize organs were 100% in each sample time (7–35 days). The same results were observed in leaf tissues for M. anisopliae, but the fungus was not constantly detected at 100% in maize stems and leaves.
When compared with traditional soil cultural systems, hydroponic culture systems are popular for industrial production of vegetables, but not so often for ecological study between microbes and plants. In this study, a hydroponic cultural system instead of a soil cultural system was used to assess fungal colonization and growth-promoting effects of B. bassiana and M. anisopliae on maize. Soil, as the most widely used culture substrate, might obscure the relationship between entomopathogenic fungi and maize crops, due to the complexities involved in a soil cultural system including soil microorganisms, soil organic matter, soil textural composition et al. In a hydroponic culture system, environmental factors are simple and constant, making repeatable results and clearer elucidation of the biological relationship just between fungi and plants possible. After inoculation, B. bassiana or M. anisopliae were isolated and PCR detected from the maize stems, leaves and roots, proving fungal transfer in maize tissues. These results were in consistent with the observation of Spiridon Mantzoukas et al.2, where fungal transfer was confirmed by isolating fungi from different parts of leaves (7 days, 14 days, 21 days and 35 days), roots (35 days), stems (35 days) and buds (35 days). Thus, fungal transfer in maize tissues could happen in the hydroponic culture system.
FRRs from different maize tissues showed temporal and spatial dynamics for B. bassiana and M. anisopliae. For both fungi, maize leaves were ideal sites over time, somewhat different from Akutse’s research, where fungus was hardly detected in bean leaf tissue22. As monitored by culturing maize tissues on the fungal selective medium, FRRs showed a dependence on the type of plant tissues. Certain endophytic fungi exhibit a degree of tissue specificity as they adapt to existing conditions in each organ23,24,25,26. Guo et al.27 reported that the tissue specificity of endophytic fungi results from their adaptation to the unique conditions of the plant organs.
Inoculation method is crucial to fungal colonization pattern28. Parsa et al.29 found that B. bassiana could colonize endogenously when the plants were treated by spraying or irrigating, while the roots could only be colonized only by irrigation. In sorghum, Tefera and Vidal reported higher rates of B. bassiana colonization in stems by leaf inoculation, and higher rates in roots and stems by seed inoculation. In the current work, root inoculation of both fungi was conducted by adding conidia suspensions directly into the hydroponic cultural system. This method might enhance the fungal transmission efficiency since the flowing water can help the fungal conidia to move toward maize crop roots. Beside inoculation method, other factors such as soil microbes, temperature, relative humidity, growth medium, plant age and species, inoculum density and fungal species may be involved in a successful colonization of fungi in different plant tissues28.
Furtherly, PCR amplification of fungus-specified DNA band provides a new and sensitive method for fungal endophytes detection. For example, the FRR of B. bassiana was tested to be low by culturing plant tissues on fungal selective medium, but was tested to be 100% by PCR. Low endophytic fungal population density in plant tissues or biological inhibition from the plant tissues may contribute the failure of fungal growth on selective medium. The PCR amplification method could be reliably used in endophytic fungi study.
Previous studies revealed that some endophytic entomopathogens can promote plants growth as biofertilizers. Jaber et al.16 reported higher stem height, root length, fresh root weight, and stem weight than uninoculated plants 14 days after inoculating wheat seeds with B. bassiana. Russo et al.30 reported increased plant height, leaf number, plant height and the number of nodes on the first cob after spraying B. bassiana on maize leaves.
In our study, the two selected entomopathogenic fungi, B. bassiana and M. anisopliae, also significantly promoted the growth of maize in a plant hydroponic cultural system, and established a systematic colonization in different tissues in maize seedlings tissues for an expected long-term growth promotion.
In contrast, Moloinyane et al.31 did not find any significant differences in plant height, root and leaf number, fresh and dry weight between B. bassiana treated and untreated grapes even 4 weeks after soil drenching treatment. This is not surprising since the endophytic abilities of a particular fungal strain may be strongly associated with host plant species, plant species varieties22, nutritional conditions and environmental influences. Tall and Melying32 studied the effects of B. bassiana (GHA) seed treatment on maize growth. They found that B. bassiana can only be used as a growth promoter of maize only when nutrients were abundant, while no growth promotion effect was noticed in the absence of nutrients. So, mechanisms of plant responses to the fungal endophytism are far from clear and need further examination.
We studied entomopathogenic fungi, B. bassiana and M. anisopliae played their roles as maize growth promoters. However, it is unclear whether, rhizospheric or endophytic is the dominant mechanism? We tracked the population dynamics of B. bassiana and M. anisopliae in plant hydroponic solution and in plant tissues, hoping to shed light on the mechanism. In terms of CFUs, the populations of B. bassiana and M. anisopliae in the hydroponic solution rapidly decreased. After 1 week, a residual percentage of less than 10% of M. anisopliae and 1% of B. bassiana was detected, while both fungi were hardly detected on the 28th day in the maize culturing hydroponic solution. In a control study, both fungal conidia could maintain high viability after 1 week in the hydroponic culture system. Thus, the fungal endophytes, influenced by the conidia adhesion, host recognition and endogenous pathway33,34,35,36,37, was the main reason for the sharp decrease of fungal populations in the hydroponic culture system. Furthermore, the growth promotion function of the fungi was mainly due to the endophytic function rather than the rhizospheric function.
Normally, biological functions are density-dependent. The relationship between plant growth promotion and population density of endophytic fungi cannot be clearly clarified until the population of endophytic fungi in plant tissues could be quantitatively detected. The plant growth promotion mechanism still needs further exploration in the entomopathogenic fungi-plants interaction system. The entomopathogenic fungi exhibit great potential not only on both bio-control of pests but also on plant growth promotion, bringing us a new sight on ecological relationship among plants, insect pests, and entomopathogenic fungi.
The EPF strains B. bassiana Bb-13 and M. anisopliae Ma-73 were used in the study. These fungi are stored in the RCEF strain Bank, Provincial Key Laboratory of Microbial Control, Anhui Agricultural University.
The conidia suspension of B. bassiana and M. anisopliae strain were inoculated on PDA and SDAY medium respectively. After 14–18 days of cultivation, conidia were harvested by scraping conidia from the agar surface with a sterile inoculation shovel, and certain amount of conidia was put in sterilized 0.05% Tween-80 (v/v) and which was well mixed to make fungal conidia suspensions38,39. Conidial concentrations were determined using a hemacytometer and the final suspension was adjusted to 1 × 107 conidia mL−1.
Maize (Z. mays, Jingnuo No.1) seeds were purchased from Shouguang Yino Agricultural Science and Technology Co., LTD. The maize (100 seeds for one treatment) were seeded in breeding discs, each one with 32 holes (5.4 × 6 × 5 cm) containing sterilized culture substrates (Klasmann peat, German) (about 30 g of sterile soil is placed in per hole). One seed was placed per hole one seed. All maize seedlings are cultivated in a greenhouse for 14 days with automatically controlled environmental factors (25 ± 1 °C, 70 ± 5% RH and 16L: 8D regime).
Ninety maize seedlings with even and well-good growth were randomly sampled for each treatment. The culture substrates on roots of each maize seedling were gently washed out with distilled water, avoiding any damage to the roots. The treated maize seedlings with even growth condition including aboveground and underground parts were transplanted to a maize hydroponic culturing system.
The maize hydroponic culturing system was constructed with an opaque plastic box (Working box specification: length × width × height of = 67 × 42 × 17.5 cm3) covered by an opaque plastic plate with 40 holes, in which 45L 1/2 half Hoagland nutrient solution (1/2) was added as hydroponic nutrient solution. A maize seedling was carefully transplanted in a culturing hole by fixing the plant stem with a sponge block40. Oxygen supply for the maize hydroponic culturing system was supported by a small ventilation pump (Risheng Group Co. LTD., CHN).
After two-day domestication for maize seedlings, 100 ml of conidia suspension with 1 × 107 conidia mL−1 was added into each hydroponic solution. Eighty plants were used as the control, in which 100 ml of sterile 0.05% Tween-80 (v/ v) was added.
Maize seedlings were weekly sampled at random for each fungal treatment and the control. All plant growth indexes including plant height, root length, leaf length, leaf width, number of leaves, and fresh weight (the above-ground, underground and the total) were carefully measured20. The weight of above and below ground parts was separately weighed in an analytical balance (Yue Ping Scientific Instrument Co., LTD., CHN). All measurements were conducted by eight randomly sampled maize seedlings with two separate batches.
Population density of B. bassiana and M. anisopliae in hydroponic solution were periodically monitored by the 7th day. One milliliter hydroponic solution was randomly sampled 5 times at a depth of 2 cm with a micropipette. The sampled hydroponic solutions were gradient diluted to 10, 100, 1000, 10,000 times with 0.05% Tween 80. After that, 100 uL of hydroponic solutions at 5 concentrations was sampled and evenly spread on a petri dish for fungal growth. Five repeats of BSM (Beauveria selective medium, quarter strength PDA containing 350 mgL−1 streptomycin sulfate, 50 mgL−1 tetracycline hydrochloride and 125 mgL−1 cycloheximide) petri dishes were used to assess the fungal population by terms of CFUs. The petri dishes were incubated at (25 ± 1) °C for fungal growth. The fungal colonies on the petri dishes were counted and identified. The optimal diluted concentration of the sampled hydroponic solution was the CFU number between 10 and 100 CFUs/plate41. The CFUs in the optimal range was used to value population dynamic in the hydroponic solutions.
The fungus was re-isolated by culturing tissues of the roots, stems and leaves of maize seedlings, inoculated with B. bassiana or M. anisopliae as rhizospheric fungus, on fungal selective medium to confirm fungal endophytic. Firstly, tissues of roots, stems and leaves were cut into pieces with 0.5 cm of length (roots and stems) or 0.5 cm2(leaves), and the small pieces of tissues were sterilized with 1% sodium hypochlorite for 5 min, then soaked in 75% ethanol for 1min42. Washed three times in sterilized distilled water, the tissue samples were inoculated on BSM medium and incubated at (25 ± 1) °C in the dark. Efficiency of the sterilization procedures of plant tissues was evaluated by inoculating 100 ul of the last rinse water on PDA medium to check any bacteria or fungi growth.
The BSM petri dishes were daily checked to find whether fungal colony appeared or not. Each growing fungal colony on BSM medium was inoculated on PDA or SDAY medium to identify the fungal species. Only those tissues with typical fungal colony of B. bassiana or M. anisopliae growth represented a successful fungal endogenesis in plants. Fungal recovery rates of B. bassiana or M. anisopliae in different tissues were calculated as the follows: Fungal recovery rate = [number of tissue pieces with B. bassiana or M. anisopliae colony/the total number of tissue pieces] × 10043.
All maize tissues(100 mg) for DNA extraction were sampled and sterilized as the above procedure and then cut into small pieces with sterilized surgical scissors. Each tissue sample was transferred into a 1.5 ml centrifuge tube with steel balls added39. The tube was put into liquid nitrogen for 2 min frozen, and then the tissue sample was quickly ground for 150 s in an automatic grinding machine (Jingxin Technology Co., LTD, Shanghai). DNA was extracted from the sample tissue followed the steps of fungal genomic DNA extraction kit (Vokai Biotechnology Co., LTD., Beijing). The extracted DNA quality was examined with a micro nucleic acid protein detector (Wuzhou Oriental Technology Development Co., LTD., Beijing). The extracted DNA samples were stored at − 20 °C for PCR amplification.
All extracted DNA samples were evaluated by PCR amplification with specific primers of B. bassiana (F5'-TTCCGAACCCGGTTAAGAGAC-3', R5'-TTCCGAACCCATCATCCTGC-3')44 or M. anisopliae (5'GACTCTCTTAAGGTAGCCAAATGCC3', 5'AAACTCCCCACCTGACAATG-3')45. The PCR performed by the PCR Phire kit (Vazyme,Nanjing), and the PCR reaction system (20 µL) included 1.5 uL gDNA, 10 uL 2 × Tap master mix, 0.4 uL (10 uM) primer 1, 2, respectively and ddH2O added to 20 uL. The PCR amplification protocol for B. bassiana began at 95 °C for 3 min, followed by 35 cycles consisting of 15 s at 95 °C, 15 s at 55 °C, 25 s at 72 °C, followed by a 5 min extension at 72 °C, and for M. anisopliae was followed by 40 cycles consisting of 15 s at 95 °C, 15s at 65 °C, and 15 s at 72 °C. PCR products were kept at 4 °C, and detected by electrophoresis in 1% (wt/vol) agarose gels in TBE with ethidium bromide and visualized under UV (302 nm) light (BioRad, USA).
All experimental data were analyzed using IBM SPSS Statistic (Version 20.0) for univariate ANOVA analysis, and Turkey HSD was used to test the significance of differences among treatments (P ≤ 0.05).
No permission is required for plant material as it was purchased from certified dealer of local area. The use of plants or plant materials in the present study complies with international, national and/or institutional guidelines.
The study has been conducted without violating any ethical codes of conduct.
In summary, two entomopathogenic fungi, B. bassiana and M. anisopliae, played positive roles in promoting the growth of maize seedlings after hydroponic rhizosphere inoculation. The two fungi could establish systematic colonization in tissues of all maize organs through maize roots, and established within 1 week. Fungal population dynamics in hydroponic solution and fungal colonization in maize tissues suggested that the fungal endophytic function other than rhizospheric function contributes more to the observed plant growth promotion. Fungal endophytic behavior was found to be somewhat fungal species specific. The technique of PCR amplification of special DNA bands of the fungi is a more sensitive method than the fungal colony detection method by culturing plant tissues on fungal selective medium. The technique could be used to trace fungal colonization and spatial distribution in plant tissues with higher accuracy. Further study is still needed to elucidate the mechanisms of the responses of the plant and plant pests to the fungal endophytism (Supplementary Information).
The datasets generated during the current study are available from the corresponding author on reasonable request.
A Correction to this paper has been published: https://doi.org/10.1038/s41598-022-22870-1
Faria, M. & Wraight, S. Mycoinsecticides and Mycoacaricides: A comprehensive list with worldwide coverage and international classification of formulation types. Biol. Control 43, 237–256. https://doi.org/10.1016/j.biocontrol.2007.08.001 (2007).
Mantzoukas, S. et al. Beauveria bassiana endophytic strain as plant growth promoter: The case of the grape vine Vitis vinifera. J. Fungi 7, 142. https://doi.org/10.3390/jof7020142 (2021).
Wang, C. & Feng, M.-G. Advances in fundamental and applied studies in China of fungal biocontrol agents for use against arthropod pests. Biol. Control 68, 129–135. https://doi.org/10.1016/j.biocontrol.2013.06.017 (2014).
Ferron, P. Biological control of insect pests by entomogenous fungi. Annu. Rev. Entomol. 23, 409–442. https://doi.org/10.1146/annurev.en.23.010178.002205 (2003).
Card, S., Johnson, L., Teasdale, S. & Caradus, J. Deciphering endophyte behaviour: The link between endophyte biology and efficacious biological control agents. FEMS Microbiol. Ecol. 92, fiw114. https://doi.org/10.1093/femsec/fiw114 (2016).
Article CAS PubMed Google Scholar
Bamisile, B. S., Dash, C. K., Akutse, K. S., Keppanan, R. & Wang, L. Fungal endophytes: Beyond herbivore management. Front. Microbiol. https://doi.org/10.3389/fmicb.2018.00544 (2018).
Article PubMed PubMed Central Google Scholar
Sasan, R. K. & Bidochka, M. J. The insect-pathogenic fungus Metarhizium robertsii (Clavicipitaceae) is also an endophyte that stimulates plant root development. Am. J. Bot. 99, 101–107. https://doi.org/10.3732/ajb.1100136 (2012).
Lugtenberg, B. J., Caradus, J. R. & Johnson, L. J. Fungal endophytes for sustainable crop production. FEMS Microbiol. Ecol. 92, fiw194. https://doi.org/10.1093/femsec/fiw194 (2016).
Article CAS PubMed Google Scholar
Tiwari, S. & Lata, C. Heavy metal stress, signaling, and tolerance due to plant-associated microbes: An overview. Front. Plant Sci. 9, 452. https://doi.org/10.3389/fpls.2018.00452 (2018).
Article PubMed PubMed Central Google Scholar
Zimmermann, G. Review on safety of the entomopathogenic fungus Metarhizium anisopliae. Biocontrol Sci. Technol. 17, 879–920. https://doi.org/10.1080/09583150701593963 (2007).
Behie, S. W., Jones, S. J. & Bidochka, M. J. Plant tissue localization of the endophytic insect pathogenic fungi Metarhizium and Beauveria. Fungal Ecol. 13, 112–119. https://doi.org/10.1016/j.funeco.2014.08.001 (2015).
Vega, F. E. The use of fungal entomopathogens as endophytes in biological control: A review. Mycologia 110, 4–30. https://doi.org/10.1080/00275514.2017.1418578 (2018).
Akello, J. & Sikora, R. Systemic acropedal influence of endophyte seed treatment on Acyrthosiphon pisum and Aphis fabae offspring development and reproductive fitness. Biol. Control 61, 215–221. https://doi.org/10.1016/j.biocontrol.2012.02.007 (2012).
Jaber, L. R. & Enkerli, J. Effect of seed treatment duration on growth and colonization of Vicia faba by endophytic Beauveria bassiana and Metarhizium brunneum. Biol. Control 103, 187–195. https://doi.org/10.1016/j.biocontrol.2016.09.008 (2016).
Jaber, L. R. & Enkerli, J. Fungal entomopathogens as endophytes: Can they promote plant growth?. Biocontrol Sci. Technol. 27, 28–41. https://doi.org/10.1080/09583157.2016.1243227 (2017).
Jaber, L. R. & Ownley, B. H. Can we use entomopathogenic fungi as endophytes for dual biological control of insect pests and plant pathogens?. Biol. Control 116, 36–45. https://doi.org/10.1016/j.biocontrol.2017.01.018 (2018).
Jaber, L. R. Seed inoculation with endophytic fungal entomopathogens promotes plant growth and reduces crown and root rot (CRR) caused by Fusarium culmorum in wheat. Planta 248, 1525–1535. https://doi.org/10.1007/s00425-018-2991-x (2018).
Article CAS PubMed Google Scholar
Ahmad, I., Jiménez-Gasco, M. D. M., Luthe, D. S., Shakeel, S. N. & Barbercheck, M. E. Endophytic Metarhizium robertsii promotes maize growth, suppresses insect growth, and alters plant defense gene expression. Biol. Control 144, 104167. https://doi.org/10.1016/j.biocontrol.2019.104167 (2020).
Shao-Fang, L. et al. Entomopathogen Metarhizium anisopliae promotes the early development of peanut root. Plant Prot. Sci. 53, 101–107. https://doi.org/10.17221/49/2016-PPS (2017).
Yuhong, C. et al. Effects of Beauveria bassiana inoculated with different methods on maize as growth promoter. Chin. J. Trop. Crops 38, 206–212 (2017).
Li, Z. Insect Mycology 1st edn. (Anhui Science and Technology Press, 1996).
Akutse , KS , Maniania , NK , Fiaboe , KKM , Van den Berg , J. & Ekesi , S. Endophytic colonization of Vicia faba and Phaseolus vulgaris (Fabaceae) by fungal pathogens. Diptera: Agromyzidae).Fungal Ecol.6 , 293–301 .https://doi.org/10.1016/j.funeco.2013.01.003 (2013).
Brown, K. B., Hyde, K. & Guest, D. Preliminary studies on endophytic fungal communities of Musa acuminata species complex in Hong Kong and Australia. Fungal Divers. 1, 27–51 (1998).
Cabral, D. Phyllosphere of Eucalyptus viminalis: Dynamics of fungal populations. Trans. Br. Mycol. Soc. 85, 501–511. https://doi.org/10.1016/S0007-1536(85)80047-4 (1985).
Carroll, G. & Carroll, F. Studies on the incidence of coniferous needle endophytes in the Pacific Northwest. Can. J. Bot. 56, 3034–3043. https://doi.org/10.1139/b78-367 (2011).
Fisher, P. J., Petrini, O. & Webster, J. Aquatic hyphomycetes and other fungi in living aquatic and terrestrial roots of Alnus glutinosa. Mycol. Res. 95, 543–547. https://doi.org/10.1016/S0953-7562(09)80066-X (1991).
Guo, L. D., Huang, G. R. & Wang, Y. Seasonal and tissue age influences on endophytic fungi of Pinus tabulaeformis (Pinaceae) in the Dongling Mountains, Beijing. J. Integr. Plant. Biol. 50, 997–1003. https://doi.org/10.1111/j.1744-7909.2008.00394.x (2008).
Tefera, T. & Vidal, S. Effect of inoculation method and plant growth medium on endophytic colonization of sorghum by the entomopathogenic fungus Beauveria bassiana. Biocontrol 54, 663–669. https://doi.org/10.1007/s10526-009-9216-y (2009).
Parsa, S., Ortiz, V. & Vega, F. E. Establishing fungal entomopathogens as endophytes: Towards endophytic biological control. J. Vis. Exp. https://doi.org/10.3791/50360 (2013).
Article PubMed PubMed Central Google Scholar
Russo, M. L. et al. Endophytic effects of Beauveria bassiana on corn (Zea mays) and its herbivore, Rachiplusia nu (Lepidoptera: Noctuidae). Insects 10, 110 (2019).
Article PubMed Central Google Scholar
Moloinyane, S. & Nchu, F. The effects of endophytic Beauveria bassiana inoculation on infestation level of Planococcus ficus, growth and volatile constituents of potted greenhouse grapevine (Vitis vinifera L.). Toxins https://doi.org/10.3390/toxins11020072 (2019).
Article PubMed PubMed Central Google Scholar
Tall, S. & Meyling, N. V. Probiotics for plants? Growth promotion by the entomopathogenic fungus Beauveria bassiana depends on nutrient availability. Microb. Ecol. 76, 1002–1008. https://doi.org/10.1007/s00248-018-1180-6 (2018).
Article CAS PubMed Google Scholar
Ying, S.-H., Feng, M.-G. & Keyhani, N. A carbon responsive G-protein coupled receptor modulates broad developmental and genetic networks in the entomopathogenic fungus, Beauveria bassiana. Environ. Microbiol. https://doi.org/10.1111/1462-2920.12169 (2013).
Gandía, M., Garrigues, S., Hernanz-Koers, M., Manzanares, P. & Marcos, J. F. Differential roles, crosstalk and response to the Antifungal Protein AfpB in the three Mitogen-Activated Protein Kinases (MAPK) pathways of the citrus postharvest pathogen Penicillium digitatum. Fungal Genet. Biol. 124, 17–28. https://doi.org/10.1016/j.fgb.2018.12.006 (2019).
Article CAS PubMed Google Scholar
Agrawal, Y., Khatri, I., Subramanian, S. & Shenoy, B. D. Genome sequence, comparative analysis, and evolutionary insights into chitinases of entomopathogenic fungus Hirsutella thompsonii. Genome Biol. Evol. 7, 916–930. https://doi.org/10.1093/gbe/evv037 (2015).
Article CAS PubMed PubMed Central Google Scholar
Wang, C. & St Leger, R. J. The MAD1 adhesin of Metarhizium anisopliae links adhesion with blastospore production and virulence to insects, and the MAD2 adhesin enables attachment to plants. Eukaryot. Cell 6, 808–816. https://doi.org/10.1128/ec.00409-06 (2007).
Article CAS PubMed PubMed Central Google Scholar
Zhang, S., Xia, Y. X., Kim, B. & Keyhani, N. O. Two hydrophobins are involved in fungal spore coat rodlet layer assembly and each play distinct roles in surface interactions, development and pathogenesis in the entomopathogenic fungus, Beauveria bassiana. Mol. Microbiol. 80, 811–826. https://doi.org/10.1111/j.1365-2958.2011.07613.x (2011).
Article CAS PubMed Google Scholar
Wang, Y. et al. DNA methyltransferases contribute to the fungal development, stress tolerance and virulence of the entomopathogenic fungus Metarhizium robertsii. Appl. Microbiol. Biotechnol. 101, 4215–4226. https://doi.org/10.1007/s00253-017-8197-5 (2017).
Article CAS PubMed Google Scholar
Ramakuwela, T. et al. Establishment of Beauveria bassiana as a fungal endophyte in pecan (Carya illinoinensis) seedlings and its virulence against pecan insect pests. Biol. Control 140, 104102. https://doi.org/10.1016/j.biocontrol.2019.104102 (2020).
Meng Lin, X. Y. et al. Effects of red and blue monochromatic light on growth, development and physiological characteristics of hydroponic tobacco seedlings. Acta Tabacaria Sin. 21, 55–61. https://doi.org/10.16472/j.chinatobacco.2015.001 (2015).
Cui Yuhong, B. Y., Cao, N., Liu, Y., Ghulam, A. B. & Wang, B. Effects of Beauveria bassiana inoculated with different methods on maize as growth promoter. Chin. J. Trop. Crops 38, 206–212 (2017).
McKinnon, A. C. et al. Beauveria bassiana as an endophyte: A critical review on associated methodology and biocontrol potential. Biocontrol 62, 1–17. https://doi.org/10.1007/s10526-016-9769-5 (2017).
Petrini, O. & Fisher, PJ Fungal endophytes in Salicornia perennis.Across.Bro.Mycol.Soc.87, 647–651.https://doi.org/10.1016/S0007-1536(86)80109-7 (1986).
Castrillo, L. A., Vandenberg, J. D. & Wraight, S. P. Strain-specific detection of introduced Beauveria bassiana in agricultural fields by use of sequence-characterized amplified region markers. J. Invertebr. Pathol. 82, 75–83. https://doi.org/10.1016/s0022-2011(02)00190-8 (2003).
Article CAS PubMed Google Scholar
Xingjia, L. et al. Evaluating survival ability of Metarhizium anisopliae in the peanut field by Real-Time PCR. Mycosystema 32, 710–720. https://doi.org/10.13346/j.mycosystema.2013.04.005 (2013).
We thank Prof. Yuan Liang (Biomass Molecular Engineering Center, Anhui Agricultural University) for helpful language revisions of the article.
This research was funded by the Key Project of Natural Science Research of Anhui Universities (KJ2020ZD08).
These authors contributed equally: Yinmei Liu and Youkun Yang.
Provincial Key Laboratory of Microbial Control, Anhui Agricultural University, Hefei, 230036, China
Yinmei Liu, Youkun Yang & Bin Wang
You can also search for this author in PubMed Google Scholar
You can also search for this author in PubMed Google Scholar
You can also search for this author in PubMed Google Scholar
Y.L. conceived concepts, designed experiments, collected data, analyzed results, and wrote the first draft and revised the manuscript. Y.Y. conceived concepts, reviewed the manuscript and revised it. B.W. provided funds and resources, led and supervised the research team's experimental progress, reviewed and revised the manuscript.
The authors declare no competing interests.
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
The original online version of this Article was revised: The original version of this Article contained errors in the legend of Figure 4 and the subheading `Isolation and identification of endophytic B. bassiana and M. anisopliae from different tissues of maize'. Full information regarding the corrections made can be found in the correction for this Article.
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.
Liu, Y., Yang, Y. & Wang, B. Entomopathogenic fungi Beauveria bassiana and Metarhizium anisopliae play roles of maize (Zea mays) growth promoter. Sci Rep 12, 15706 (2022). https://doi.org/10.1038/s41598-022-19899-7
DOI: https://doi.org/10.1038/s41598-022-19899-7
Anyone you share the following link with will be able to read this content:
Sorry, a shareable link is not currently available for this article.
Provided by the Springer Nature SharedIt content-sharing initiative
World Journal of Microbiology and Biotechnology (2023)
By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.
Scientific Reports (Sci Rep) ISSN 2045-2322 (online)

Gibberellic Acid 20 Soluble Powder Sign up for the Nature Briefing newsletter — what matters in science, free to your inbox daily.